The emergence of transcriptomics, fuelled by high-throughput sequencing technologies, has changed the nature of cancer research and resulted in a massive accumulation of data. Computational analysis, integration, and data visualization are now major bottlenecks in cancer biology and translational research. ...
Read More »Long non-coding RNAs in lung cancer: comparison of microarray and RNA-seq techniques
from F1000 Posters PV Nazarov*, T Kaoma, A Muller, S Fritah, L Vallar *Corresponding author: PV Nazarov Genomics Research Unit, CRP-Sante, Luxembourg, Luxembourg F1000Posters 2013, 4: 1446 (poster) [English] Poster [1.22 MB] Presented at: Benelux Bioinformatics Conference 2013 , 9 ...
Read More »In Search of RNA Epigenetics: A Grand Challenge
from Zone in with Zon by Jerry Zon Methylated riboA and riboC are the most commonly detected nucleobases in epigenetics research Powerful new analytical methods are key tools for progress Promising PacBio sequencing and novel “Pan Probes” reported In ...
Read More »The characteristic direction: a geometrical approach to identify differentially expressed genes
Identifying differentially expressed genes (DEG) is a fundamental step in studies that perform genome wide expression profiling. Typically, DEG are identified by univariate approaches such as Significance Analysis of Microarrays (SAM) or Linear Models for Microarray Data (LIMMA) for processing ...
Read More »Sequencing localized RNA in single cells by FISH
from greenfluorescentblog by Gal Haimovich To celebrate the 2-year anniversary of this blog, lets talk about the new Science paper in which the authors claim to performs in situ single cell, single molecule RNA sequencing. So what’s the big deal? Well, ...
Read More »Partek Microarray and NGS Analysis Workshop
Event: > Partek Microarray and NGS Analysis Workshop Date: April 1, 2014 Cost: Free Category: Training Contact: PARTEK Email: [email protected] Updated: March 19, 2014 Venue: Multimedia training room 3.142, Queensland Bioscience Precinct Address: Building 80, The University of Queensland, 306 ...
Read More »Quality assessment and control of tissue specific RNA-seq libraries
RNA-sequencing (RNA-seq) is rapidly emerging as the technology of choice for whole-transcriptome studies. However, RNA-seq is not a bias free technique. It requires large amounts of RNA and library preparation can introduce multiple artifacts, compounded by problems from later stages ...
Read More »Past RNA-Seq Workshops – The Broad Institute
De novo & Genome-guided Transcript Reconstruction from RNA-Seq Participants in this workshop will learn the basics of how to reconstruct and analyze transcriptomes starting from RNA-Seq data using genome-guided and genome-free methods. Genome-guided reconstruction will be performed using the Tuxedo ...
Read More »Free pass to RNA-Seq 2014 up for grabs
Fancy a FREE PASS to RNA-Seq 2014? Simply crack this RNA Code and it could be yours! 5’ AUGAAUGAGGGCGCGAUACCCGAAACAAGUCAAGCCUUUAUGUGCAACGAAUGA 3’ __ __ X I __ __ Z E __ ...
Read More »Group reports the results of phase 1 of the ABRF-NGS study at ABRF 2014
The ABRF Next Generation Sequencing Study: Multi-platform and Cross-methodological Reproducibility of Transcriptome Profiling by RNA-seq Next generation sequencing (NGS) has dramatically expanded the potential for novel genomics discoveries, but the wide variety of platforms, protocols, and performance has created the ...
Read More »