RNA-Seq Blog Transcriptome Research & Industry News
Fancy a FREE PASS to RNA-Seq 2014? Simply crack this RNA Code and it could be yours! 5’ AUGAAUGAGGGCGCGAUACCCGAAACAAGUCAAGCCUUUAUGUGCAACGAAUGA 3’ __ __ X I __ __ Z E __ ...
Read More »Free pass to RNA-Seq 2014 up for grabs
Don't Miss
- Researchers construct a high-resolution single-nucleus RNA sequencing (snRNA-seq) analysis of gene expression changes across all brain cell
- Zebrahub – a single-embryo single-cell RNA sequencing atlas of zebrafish development
- Post-doc position available – RNA Accelerator Inflammation and Immunology
- BEETLE ATLAS – a definitive, tissue-specific transcriptomic resource based on RNA-Seq data for the Tribolium community
- ElasticBLAST – accelerating sequence search via cloud computing
- TileDB launches cross-language access to single-cell data
- Researchers have developed an instrument-free single-cell RNA sequencing using a reversible hydrogel for cell-specific barcoding
- Transcriptomic analysis of yeast paves way to more efficient production of 2G ethanol
- Upcoming Webinar – RNA-Seq: Enhancing Single-Cell Data & Cell Recovery Rates for Complex Tissue Samples
- Illumina launches new software to enable tertiary analysis for oncology applications, and soon rare disease