Tag Archives: rna-seq 2014

Sequencing is opening an array of doors into the transcriptome and Lexogen are holding some of the important keys tothese gateways Jungsoo Park has decades of experience in the biotech industry with his main focus on genomic technologies. He started ...

As we delve ever deeper into the complexity of disease, RNA-Sequencing has emerged as a fundamental tool in the arsenal of researchers. As we delve ever deeper into the complexity of disease, RNA-Sequencing has emerged as a fundamental tool in ...

8 presentations from the RNA-Seq series so far. All nicely collated for you in a ‘Past Presentation Pack’. There are a number of presentations in there from our European RNA-Seq meeting (which took place in December last year), giving you ...

  Fancy a FREE PASS to RNA-Seq 2014? Simply crack this RNA Code and it could be yours! 5’ AUGAAUGAGGGCGCGAUACCCGAAACAAGUCAAGCCUUUAUGUGCAACGAAUGA 3’ __ __   X    I   __  __   Z     E        __   ...

Master RNA-Sequencing to Crack the Transcriptome RNA-Seq 2014 is the 2nd annual summit which will once again be the key to unlocking the commercial potential stored in RNA. RNASeq 2014 remains the industry’s only conference solely dedicated to maximizing the ...