Sequencing is opening an array of doors into the transcriptome and Lexogen are holding some of the important keys tothese gateways Jungsoo Park has decades of experience in the biotech industry with his main focus on genomic technologies. He started ...
Read More »Talk of the Transcriptome – RNA-Seq 2014
As we delve ever deeper into the complexity of disease, RNA-Sequencing has emerged as a fundamental tool in the arsenal of researchers. As we delve ever deeper into the complexity of disease, RNA-Sequencing has emerged as a fundamental tool in ...
Read More »RNA-Seq Presentations – Available for Download
8 presentations from the RNA-Seq series so far. All nicely collated for you in a ‘Past Presentation Pack’. There are a number of presentations in there from our European RNA-Seq meeting (which took place in December last year), giving you ...
Read More »Free pass to RNA-Seq 2014 up for grabs
Fancy a FREE PASS to RNA-Seq 2014? Simply crack this RNA Code and it could be yours! 5’ AUGAAUGAGGGCGCGAUACCCGAAACAAGUCAAGCCUUUAUGUGCAACGAAUGA 3’ __ __ X I __ __ Z E __ ...
Read More »Final Agenda Released – RNA-Seq 2014
Master RNA-Sequencing to Crack the Transcriptome RNA-Seq 2014 is the 2nd annual summit which will once again be the key to unlocking the commercial potential stored in RNA. RNASeq 2014 remains the industry’s only conference solely dedicated to maximizing the ...
Read More »